Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGTCCACACTCTTAACTACACTGTA[A/G]AGGTCACAAGGTCTGAGAGAAACTG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
|||||||||||||||||||||
Literature Links: |
PLEKHD1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
PLEKHD1 - pleckstrin homology and coiled-coil domain containing D1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001161498.1 | Intron | NP_001154970.1 | ||||
XM_011536762.2 | Intron | XP_011535064.1 | ||||
XM_011536763.2 | Intron | XP_011535065.1 | ||||
XM_017021290.1 | Intron | XP_016876779.1 |
SLC39A9 - solute carrier family 39 member 9 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |