Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TAAACTTTATATTAACATCCTAAAG[G/T]TAAACATGAAAATTCTTCTATAACA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 614313 MIM: 611919 | ||||||||||||||||||||
Literature Links: |
ACOT1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ACOT1 - acyl-CoA thioesterase 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
C14orf169 - chromosome 14 open reading frame 169 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
HEATR4 - HEAT repeat containing 4 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001220484.1 | Intron | NP_001207413.1 | ||||
NM_203309.2 | Intron | NP_976054.2 | ||||
XM_006720143.2 | Intron | XP_006720206.1 | ||||
XM_011536760.2 | Intron | XP_011535062.1 | ||||
XM_011536761.2 | Intron | XP_011535063.1 | ||||
XM_017021289.1 | Intron | XP_016876778.1 |