Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCCTGAGCCAGGAGGAGAGGAGAAA[A/G]TCCAAGGAAAGATGGTGAGTGTGGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 180660 MIM: 612308 | ||||||||||||||||||||
Literature Links: |
POLR2A PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
POLR2A - RNA polymerase II subunit A | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SLC35G6 - solute carrier family 35 member G6 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001102614.1 | Intron | NP_001096084.1 |
ZBTB4 - zinc finger and BTB domain containing 4 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001128833.1 | Intron | NP_001122305.1 | ||||
NM_020899.3 | Intron | NP_065950.2 | ||||
XM_006721563.3 | Intron | XP_006721626.1 | ||||
XM_006721564.2 | Intron | XP_006721627.1 | ||||
XM_011523972.2 | Intron | XP_011522274.1 |