Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCGTGTTTTCTCTCCTTTGTCTTTA[C/G]GGGTGTGGCCTGTTCAGCACCAGCT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 606371 MIM: 604643 MIM: 605053 | ||||||||||||||||||||
Literature Links: |
ATF7 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ATF7 - activating transcription factor 7 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001130060.1 | 3579 | UTR 3 | NP_001123532.1 | |||
NM_001206682.1 | 3579 | Intron | NP_001193611.1 | |||
NM_001206683.1 | 3579 | Intron | NP_001193612.1 | |||
NM_006856.2 | 3579 | UTR 3 | NP_006847.1 | |||
XM_005268587.3 | 3579 | UTR 3 | XP_005268644.1 | |||
XM_017018722.1 | 3579 | UTR 3 | XP_016874211.1 |
LOC100652999 - uncharacterized LOC100652999 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NPFF - neuropeptide FF-amide peptide precursor | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TARBP2 - TARBP2, RISC loading complex RNA binding subunit | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |