Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GTCCCACCGCTATAAAGGACACGTC[G/A]GTCAGCATCTCGGAGTGAGACGCTT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
47 submissions
|
||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 612090 MIM: 612091 MIM: 612094 | ||||||||||||||||||||||||||||||||||||||||||||||||||
Literature Links: |
MIR200A PubMed Links | ||||||||||||||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | ||||||
---|---|---|---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU)
|
||||||
EAS
|
African American - Not Available | YRI (Yoruba)
|
||||||
SAS
|
Chinese - Not Available | JPT (Japanese)
|
||||||
AFR
|
Japanese - Not Available | CHB (Han Chinese)
|
||||||
EUR
|
||||||||
AMR
|
MIR200A - microRNA 200a | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR200B - microRNA 200b | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR429 - microRNA 429 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TTLL10 - tubulin tyrosine ligase like 10 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001130045.1 | Intron | NP_001123517.1 | ||||
NM_153254.2 | Intron | NP_694986.2 | ||||
XM_005244738.1 | Intron | XP_005244795.1 | ||||
XM_011541177.2 | Intron | XP_011539479.1 | ||||
XM_017000906.1 | Intron | XP_016856395.1 | ||||
XM_017000907.1 | Intron | XP_016856396.1 | ||||
XM_017000908.1 | Intron | XP_016856397.1 | ||||
XM_017000909.1 | Intron | XP_016856398.1 | ||||
XM_017000910.1 | Intron | XP_016856399.1 | ||||
XM_017000911.1 | Intron | XP_016856400.1 | ||||
XM_017000912.1 | Intron | XP_016856401.1 |
TTLL10-AS1 - TTLL10 antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |