Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TTGCTGCAGGGTGCCTGGTCATGCA[A/G]ACAGGGCTTCCGTACACCTGCTGCT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 604414 | ||||||||||||||||||||
Literature Links: |
C22orf23 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
C22orf23 - chromosome 22 open reading frame 23 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001207062.1 | Intron | NP_001193991.1 | ||||
NM_032561.4 | Intron | NP_115950.3 | ||||
XM_005261781.1 | Intron | XP_005261838.1 | ||||
XM_005261782.3 | Intron | XP_005261839.1 | ||||
XM_005261783.2 | Intron | XP_005261840.1 | ||||
XM_005261784.2 | Intron | XP_005261841.1 |
MICALL1 - MICAL like 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
POLR2F - RNA polymerase II subunit F | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |