Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TTGATATATATATATCAAATAATGT[A/C]CAATATCAGCACAATTATGTAAATG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 604799 MIM: 612393 | ||||||||||||||||||||
Literature Links: |
HOMER2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
HOMER2 - homer scaffolding protein 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_004839.3 | 7289 | Intron | NP_004830.2 | |||
NM_199330.2 | 7289 | Intron | NP_955362.1 | |||
XM_005272448.4 | 7289 | Intron | XP_005272505.1 | |||
XM_005272449.3 | 7289 | Intron | XP_005272506.1 | |||
XM_006720775.3 | 7289 | UTR 3 | XP_006720838.1 | |||
XM_006720776.3 | 7289 | Intron | XP_006720839.1 | |||
XM_011522231.2 | 7289 | Intron | XP_011520533.1 | |||
XM_011522232.2 | 7289 | Intron | XP_011520534.1 | |||
XM_011522233.2 | 7289 | Intron | XP_011520535.1 | |||
XM_011522234.2 | 7289 | Intron | XP_011520536.1 |
WHAMM - WAS protein homolog associated with actin, golgi membranes and microtubules | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |