Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGGGGTCGGGGCAGGCAGTAGCTGT[A/C]CCGTGCTGGGCAACTCATCTAGGGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 607170 | ||||||||||||||||||||
Literature Links: |
CRELD1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CRELD1 - cysteine rich with EGF like domains 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001031717.3 | 4829 | Intron | NP_001026887.1 | |||
NM_001077415.2 | 4829 | Intron | NP_001070883.1 | |||
NM_015513.4 | 4829 | Intron | NP_056328.2 | |||
XM_011534108.1 | 4829 | Intron | XP_011532410.1 | |||
XM_017007175.1 | 4829 | Intron | XP_016862664.1 |
PRRT3 - proline rich transmembrane protein 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001318871.1 | 4829 | Intron | NP_001305800.1 | |||
NM_207351.4 | 4829 | Missense Mutation | GGA,GTA | G,V 938 | NP_997234.3 | |
XM_011533628.2 | 4829 | Missense Mutation | GGA,GTA | G,V 938 | XP_011531930.1 | |
XM_011533629.2 | 4829 | Missense Mutation | GGA,GTA | G,V 938 | XP_011531931.1 | |
XM_017006256.1 | 4829 | Missense Mutation | GGA,GTA | G,V 938 | XP_016861745.1 |
PRRT3-AS1 - PRRT3 antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |