Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TAGAGGCATCTGGTGTCCTAATACA[C/T]GCATGCCTTTGACCCTTTGTACCAG
Species: |
Human | |||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||
Phenotype: |
||||||||||||||||||||||||
Literature Links: |
ARPC4-TTLL3 PubMed Links | |||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR - Not Available | |||||
AMR - Not Available |
ARPC4-TTLL3 - ARPC4-TTLL3 readthrough | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC107986062 - endogenous retrovirus group K member 9 Pol protein-like | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RPUSD3 - RNA pseudouridylate synthase domain containing 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001142547.1 | Intron | NP_001136019.1 | ||||
NM_173659.3 | Intron | NP_775930.2 | ||||
XM_011533627.2 | Intron | XP_011531929.1 |
TTLL3 - tubulin tyrosine ligase like 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |