Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGAAGTCTAAACAAGCCTGCGTCTC[C/T]TGGTTTTCTCAAGTGGCGTTTCATC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
35 submissions
|
||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 606366 | ||||||||||||||||||||||||||||||||||||||||||||||||||
Literature Links: |
DUSP5P1 PubMed Links | ||||||||||||||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | ||||||
---|---|---|---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU)
|
||||||
EAS
|
African American - Not Available | YRI (Yoruba)
|
||||||
SAS
|
Chinese - Not Available | JPT (Japanese)
|
||||||
AFR
|
Japanese - Not Available | CHB (Han Chinese)
|
||||||
EUR
|
||||||||
AMR
|
DUSP5P1 - dual specificity phosphatase 5 pseudogene 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC105373132 - uncharacterized LOC105373132 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
XM_011544354.2 | 1641 | UTR 5 | XP_011542656.1 |
RHOU - ras homolog family member U | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_021205.5 | 1641 | Intron | NP_067028.1 |
RNA5S14 - RNA, 5S ribosomal 14 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RNA5S15 - RNA, 5S ribosomal 15 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RNA5S16 - RNA, 5S ribosomal 16 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RNA5S17 - RNA, 5S ribosomal 17 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
Set Membership: |
HapMap |