Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CACTGACGGAACAGGCCTGTCTGCA[A/G]AGTAATTTCCAGTTCTGTGGTGCGG
Species: |
Human | |||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||||||||
Phenotype: |
MIM: 603167 MIM: 600230 | |||||||||||||||||||||||||||||
Literature Links: |
BAD PubMed Links | |||||||||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU)
|
|||
EAS - Not Available | African American - Not Available | YRI (Yoruba)
|
|||
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR - Not Available | Japanese - Not Available | JPT (Japanese)
|
|||
EUR - Not Available | |||||
AMR - Not Available |
BAD - BCL2 associated agonist of cell death | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_004322.3 | Intron | NP_004313.1 | ||||
NM_032989.2 | Intron | NP_116784.1 |
GPR137 - G protein-coupled receptor 137 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001170726.1 | Intron | NP_001164197.1 | ||||
NM_001170880.1 | Intron | NP_001164351.1 | ||||
NM_001170881.1 | Intron | NP_001164352.1 | ||||
NM_001177358.1 | Intron | NP_001170829.1 | ||||
NM_020155.3 | Intron | NP_064540.3 | ||||
XM_005274100.2 | Intron | XP_005274157.1 | ||||
XM_005274101.2 | Intron | XP_005274158.1 | ||||
XM_005274102.2 | Intron | XP_005274159.1 | ||||
XM_005274104.2 | Intron | XP_005274161.1 | ||||
XM_011545168.2 | Intron | XP_011543470.1 | ||||
XM_011545169.1 | Intron | XP_011543471.1 | ||||
XM_011545170.2 | Intron | XP_011543472.1 | ||||
XM_011545171.2 | Intron | XP_011543473.1 | ||||
XM_011545172.2 | Intron | XP_011543474.1 | ||||
XM_017018014.1 | Intron | XP_016873503.1 | ||||
XM_017018015.1 | Intron | XP_016873504.1 | ||||
XM_017018016.1 | Intron | XP_016873505.1 |
PLCB3 - phospholipase C beta 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |