Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACCCTTTGGGGCTGAATGCGACCCC[A/C]CTGCCCCAAGACTCAAGCTTGGTGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 610827 | ||||||||||||||||||||
Literature Links: |
LOC107985388 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
LOC107985388 - pre-mRNA-splicing factor cwc22-like | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PCIF1 - PDX1 C-terminal inhibiting factor 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_022104.3 | 557 | Silent Mutation | CCA,CCC | P,P 93 | NP_071387.1 | |
XM_011528980.2 | 557 | Silent Mutation | CCA,CCC | P,P 93 | XP_011527282.1 | |
XM_011528981.2 | 557 | Silent Mutation | CCA,CCC | P,P 93 | XP_011527283.1 | |
XM_017028013.1 | 557 | Silent Mutation | CCA,CCC | P,P 93 | XP_016883502.1 | |
XM_017028014.1 | 557 | UTR 5 | XP_016883503.1 |
ZNF335 - zinc finger protein 335 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |