Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TTCATGAAAACAAACAAGGCCATGC[C/T]TCAGCACAGGAAGAGGCAGTATGAT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 609088 MIM: 605109 | ||||||||||||||||||||
Literature Links: |
FBXL22 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
FBXL22 - F-box and leucine rich repeat protein 22 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
HERC1 - HECT and RLD domain containing E3 ubiquitin protein ligase family member 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_003922.3 | Intron | NP_003913.3 | ||||
XM_017022699.1 | Intron | XP_016878188.1 | ||||
XM_017022700.1 | Intron | XP_016878189.1 | ||||
XM_017022701.1 | Intron | XP_016878190.1 | ||||
XM_017022702.1 | Intron | XP_016878191.1 | ||||
XM_017022703.1 | Intron | XP_016878192.1 | ||||
XM_017022704.1 | Intron | XP_016878193.1 | ||||
XM_017022705.1 | Intron | XP_016878194.1 | ||||
XM_017022706.1 | Intron | XP_016878195.1 |