Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGAGCAGGAGCCTGTGGCGGCAACA[C/T]GTAGGTAGCATTTCCAGGGGCCTGT
Species: |
Human | |||||||||||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 600659 MIM: 606422 MIM: 613701 | |||||||||||||||||||||||||||||||||||||||||||||||
Literature Links: |
E2F4 PubMed Links | |||||||||||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | ||||||
---|---|---|---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU)
|
||||||
EAS
|
African American - Not Available | YRI (Yoruba)
|
||||||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | ||||||
AFR
|
Japanese - Not Available | JPT (Japanese)
|
||||||
EUR
|
||||||||
AMR
|
E2F4 - E2F transcription factor 4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ELMO3 - engulfment and cell motility 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC105369155 - uncharacterized LOC105369155 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LRRC29 - leucine rich repeat containing 29 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001004055.1 | 1278 | UTR 3 | NP_001004055.1 | |||
NM_012163.2 | 1278 | UTR 3 | NP_036295.1 | |||
XM_017023126.1 | 1278 | UTR 3 | XP_016878615.1 | |||
XM_017023127.1 | 1278 | UTR 3 | XP_016878616.1 | |||
XM_017023128.1 | 1278 | UTR 3 | XP_016878617.1 | |||
XM_017023129.1 | 1278 | UTR 3 | XP_016878618.1 | |||
XM_017023130.1 | 1278 | UTR 3 | XP_016878619.1 | |||
XM_017023131.1 | 1278 | UTR 3 | XP_016878620.1 | |||
XM_017023132.1 | 1278 | UTR 3 | XP_016878621.1 | |||
XM_017023133.1 | 1278 | UTR 3 | XP_016878622.1 | |||
XM_017023134.1 | 1278 | UTR 3 | XP_016878623.1 |
MIR328 - microRNA 328 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |