Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TTGATGTGGTGGGAGGGAGGAGGAG[C/G]CGGTGCTGGCACGATCACCGTGGGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 600743 | ||||||||||||||||||||
Literature Links: |
LINC01569 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
LINC01569 - long intergenic non-protein coding RNA 1569 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC105371063 - putative uncharacterized protein encoded by LINC00596 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TFAP4 - transcription factor AP-4 (activating enhancer binding protein 4) | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_003223.2 | 1111 | Missense Mutation | CCT,GCT | P,A 241 | NP_003214.1 | |
XM_011522633.2 | 1111 | Missense Mutation | CCT,GCT | P,A 228 | XP_011520935.1 | |
XM_011522635.2 | 1111 | Missense Mutation | CCT,GCT | P,A 181 | XP_011520937.1 |