Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ATTTTAAAATATTTTCTATTGCTGA[A/G]CTGTGTCATTTTGGCTGCAATATTT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 614444 | ||||||||||||||||||||
Literature Links: |
GARNL3 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
GARNL3 - GTPase activating Rap/RanGAP domain like 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001286779.1 | Intron | NP_001273708.1 | ||||
NM_032293.4 | Intron | NP_115669.3 | ||||
XM_005252267.3 | Intron | XP_005252324.1 | ||||
XM_005252268.2 | Intron | XP_005252325.1 | ||||
XM_011519086.2 | Intron | XP_011517388.1 | ||||
XM_011519087.2 | Intron | XP_011517389.1 | ||||
XM_011519089.2 | Intron | XP_011517391.1 | ||||
XM_011519090.2 | Intron | XP_011517392.1 | ||||
XM_017015202.1 | Intron | XP_016870691.1 |
RALGPS1 - Ral GEF with PH domain and SH3 binding motif 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |