Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TTCCCCTTCAACCTCTGGCTTTTCA[A/G]ACTGAAGGATCCTTGAAGCCTGGCT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 116953 MIM: 155550 MIM: 179514 | ||||||||||||||||||||
Literature Links: |
CDK2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CDK2 - cyclin dependent kinase 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001290230.1 | Intron | NP_001277159.1 | ||||
NM_001798.4 | Intron | NP_001789.2 | ||||
NM_052827.3 | Intron | NP_439892.2 | ||||
XM_011537732.1 | Intron | XP_011536034.1 |
PMEL - premelanosome protein | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RAB5B - RAB5B, member RAS oncogene family | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |