Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TAACATTTTCTGGATTCTTAGGGTT[A/T]AATTATTCAAGTATATGGATGTTAA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 608368 MIM: 606932 | ||||||||||||||||||||
Literature Links: |
FAM216A PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
FAM216A - family with sequence similarity 216 member A | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RAD9B - RAD9 checkpoint clamp component B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
VPS29 - VPS29, retromer complex component | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001282150.1 | Intron | NP_001269079.1 | ||||
NM_001282151.1 | Intron | NP_001269080.1 | ||||
NM_016226.4 | Intron | NP_057310.1 | ||||
NM_057180.2 | Intron | NP_476528.1 | ||||
XM_006719459.3 | Intron | XP_006719522.1 | ||||
XM_006719460.3 | Intron | XP_006719523.1 | ||||
XM_011538484.2 | Intron | XP_011536786.1 | ||||
XM_017019457.1 | Intron | XP_016874946.1 | ||||
XM_017019458.1 | Intron | XP_016874947.1 | ||||
XM_017019459.1 | Intron | XP_016874948.1 |