Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CTGTGTTCAGGGAGTTCTTGGTCTA[G/T]CAGGGGAGAGCCGTGGGTGCAAGGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 605511 MIM: 605736 | ||||||||||||||||||||
Literature Links: |
TMPRSS3 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
TMPRSS3 - transmembrane protease, serine 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
UBASH3A - ubiquitin associated and SH3 domain containing A | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001001895.2 | Intron | NP_001001895.1 | ||||
NM_001243467.1 | Intron | NP_001230396.1 | ||||
NM_018961.3 | Intron | NP_061834.1 | ||||
XM_006724013.3 | Intron | XP_006724076.1 | ||||
XM_011529605.2 | Intron | XP_011527907.1 | ||||
XM_011529606.2 | Intron | XP_011527908.1 | ||||
XM_011529607.2 | Intron | XP_011527909.1 | ||||
XM_011529609.1 | Intron | XP_011527911.1 | ||||
XM_011529610.2 | Intron | XP_011527912.1 |