Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACCCCTACACCGAGTTCAAGGAGTT[C/G]TCCAGGAAGCAGATCAAGGACATGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
1 submissions
|
||||||||||||||||||||
Phenotype: |
MIM: 616450 | ||||||||||||||||||||
Literature Links: |
EFHD2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
EFHD2 - EF-hand domain family member D2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_024329.5 | 342 | Missense Mutation | TTC,TTG | F,L 89 | NP_077305.2 | |
XM_005246000.3 | 342 | Missense Mutation | TTC,TTG | F,L 89 | XP_005246057.1 |
FHAD1 - forkhead associated phosphopeptide binding domain 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC101927441 - uncharacterized LOC101927441 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |