Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TACACTTCTAATGATCATACTGGCT[C/T]CAGTTAAGCTATAAATTAAAAATGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 613066 | ||||||||||||||||||||
Literature Links: |
KRT18P59 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
KRT18P59 - keratin 18 pseudogene 59 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PKNOX2 - PBX/knotted 1 homeobox 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_022062.2 | 1495 | Intron | NP_071345.2 | |||
XM_005271642.2 | 1495 | Intron | XP_005271699.1 | |||
XM_005271643.2 | 1495 | Intron | XP_005271700.1 | |||
XM_006718894.2 | 1495 | Intron | XP_006718957.1 | |||
XM_011542944.2 | 1495 | Intron | XP_011541246.1 | |||
XM_011542945.2 | 1495 | Intron | XP_011541247.1 | |||
XM_011542946.1 | 1495 | Intron | XP_011541248.1 | |||
XM_011542947.2 | 1495 | Intron | XP_011541249.1 | |||
XM_017018110.1 | 1495 | UTR 5 | XP_016873599.1 | |||
XM_017018111.1 | 1495 | Intron | XP_016873600.1 | |||
XM_017018112.1 | 1495 | Intron | XP_016873601.1 |
TMEM218 - transmembrane protein 218 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |