Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GTCAGGGAGAGACCCACTCACGCAG[A/G]GGCACCTGGCAACCTAGGGTGGCTT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 193067 MIM: 615815 | ||||||||||||||||||||
Literature Links: |
FLI1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
FLI1 - Fli-1 proto-oncogene, ETS transcription factor | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001167681.2 | Intron | NP_001161153.1 | ||||
NM_001271010.1 | Intron | NP_001257939.1 | ||||
NM_001271012.1 | Intron | NP_001257941.1 | ||||
NM_002017.4 | Intron | NP_002008.2 | ||||
XM_011542701.2 | Intron | XP_011541003.1 | ||||
XM_011542702.1 | Intron | XP_011541004.1 | ||||
XM_017017405.1 | Intron | XP_016872894.1 | ||||
XM_017017406.1 | Intron | XP_016872895.1 |
LOC101929538 - uncharacterized LOC101929538 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SENCR - smooth muscle and endothelial cell enriched migration/differentiation-associated long non-coding RNA | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |