Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TACTTTTAACAAAGTGATTGCATCT[G/T]TGAAAGAAAAGAGATCAAATCATTT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 611142 | ||||||||||||||||||||
Literature Links: |
CKAP5 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CKAP5 - cytoskeleton associated protein 5 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001008938.3 | Intron | NP_001008938.1 | ||||
NM_014756.3 | Intron | NP_055571.2 |
MIR5582 - microRNA 5582 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD67 - small nucleolar RNA, C/D box 67 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |