Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCATGTGGGGCCGGCTGGGCTTCTA[A/G]AGGTCGCCAGAGCCAGTGGCCTGCC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 300283 MIM: 300005 MIM: 300929 | ||||||||||||||||||||
Literature Links: |
IRAK1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
IRAK1 - interleukin 1 receptor associated kinase 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001025242.1 | Intron | NP_001020413.1 | ||||
NM_001025243.1 | Intron | NP_001020414.1 | ||||
NM_001569.3 | Intron | NP_001560.2 | ||||
XM_005274668.3 | Intron | XP_005274725.1 | ||||
XM_011531158.2 | Intron | XP_011529460.1 |
MECP2 - methyl-CpG binding protein 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR718 - microRNA 718 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |