Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGGAGGGATAAAAGGAACAGGGTAA[A/G]TTCAGGCCACTGACCTCCCACAGCC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 615844 MIM: 614459 | ||||||||||||||||||||||||||||||||||||||||||||
Literature Links: |
CYB561A3 PubMed Links | ||||||||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | ||||||
---|---|---|---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | ||||||
EAS
|
African American - Not Available | YRI (Yoruba)
|
||||||
SAS
|
Chinese - Not Available | CHB (Han Chinese)
|
||||||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | ||||||
EUR
|
||||||||
AMR
|
CYB561A3 - cytochrome b561 family member A3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001161452.1 | Intron | NP_001154924.1 | ||||
NM_001161454.1 | Intron | NP_001154926.1 | ||||
NM_001300763.1 | Intron | NP_001287692.1 | ||||
NM_153611.4 | Intron | NP_705839.3 | ||||
XM_011544821.1 | Intron | XP_011543123.1 | ||||
XM_011544823.1 | Intron | XP_011543125.1 | ||||
XM_011544824.1 | Intron | XP_011543126.1 | ||||
XM_017017345.1 | Intron | XP_016872834.1 | ||||
XM_017017346.1 | Intron | XP_016872835.1 | ||||
XM_017017347.1 | Intron | XP_016872836.1 |
TKFC - triokinase and FMN cyclase | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_015533.3 | Intron | NP_056348.2 | ||||
XM_011544912.2 | Intron | XP_011543214.1 | ||||
XM_017017517.1 | Intron | XP_016873006.1 | ||||
XM_017017518.1 | Intron | XP_016873007.1 | ||||
XM_017017519.1 | Intron | XP_016873008.1 | ||||
XM_017017520.1 | Intron | XP_016873009.1 | ||||
XM_017017521.1 | Intron | XP_016873010.1 | ||||
XM_017017522.1 | Intron | XP_016873011.1 | ||||
XM_017017523.1 | Intron | XP_016873012.1 | ||||
XM_017017524.1 | Intron | XP_016873013.1 |
TMEM138 - transmembrane protein 138 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |