Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCACTGGCCTCTACTCGCCACAGGT[G/T]GAAACTCAGAGGTGGGCATCAATGC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 604447 MIM: 610022 | ||||||||||||||||||||
Literature Links: |
GNB5 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
GNB5 - G protein subunit beta 5 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC100129973 - uncharacterized LOC100129973 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MYO5C - myosin VC | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_018728.3 | Intron | NP_061198.2 | ||||
XM_011521781.2 | Intron | XP_011520083.1 | ||||
XM_017022408.1 | Intron | XP_016877897.1 | ||||
XM_017022409.1 | Intron | XP_016877898.1 | ||||
XM_017022410.1 | Intron | XP_016877899.1 |