Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCCCGCCCCAGTGCTCCCAGCCCCA[C/T]GTCACGTCCAGGTGTAGCGGGGCCT
Species: |
Human | |||||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 608021 | |||||||||||||||||||||||||||||||||||||||||
Literature Links: |
LOC100287175 PubMed Links | |||||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | ||||||
---|---|---|---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | ||||||
EAS
|
African American - Not Available | YRI (Yoruba)
|
||||||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | ||||||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | ||||||
EUR
|
||||||||
AMR
|
LOC100287175 - uncharacterized LOC100287175 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MCRIP2 - MAPK regulated corepressor interacting protein 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
METTL26 - methyltransferase like 26 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001040160.2 | 338 | Silent Mutation | NP_001035250.1 | |||
NM_001040161.2 | 338 | Intron | NP_001035251.1 | |||
NM_001040162.2 | 338 | Intron | NP_001035252.1 | |||
NM_001040165.2 | 338 | Silent Mutation | NP_001035255.1 | |||
NM_001288710.1 | 338 | Silent Mutation | NP_001275639.1 | |||
NM_032366.4 | 338 | Silent Mutation | NP_115742.3 | |||
XM_011522713.2 | 338 | Silent Mutation | XP_011521015.1 | |||
XM_011522714.2 | 338 | Silent Mutation | XP_011521016.1 |
RAB40C - RAB40C, member RAS oncogene family | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
WFIKKN1 - WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |