Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGGTACACCCACATCTATTGTATTA[C/G]ACAAATCACAGAGGGATTGCAACAG
Species: |
Human | |||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||
Phenotype: |
MIM: 615882 | |||||||||||||||||||||||
Literature Links: |
RABGAP1 PubMed Links | |||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR - Not Available | Japanese - Not Available | JPT (Japanese)
|
|||
EUR - Not Available | |||||
AMR - Not Available |
RABGAP1 - RAB GTPase activating protein 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_012197.3 | Intron | NP_036329.3 | ||||
XM_011518440.2 | Intron | XP_011516742.1 | ||||
XM_011518441.2 | Intron | XP_011516743.1 | ||||
XM_011518442.2 | Intron | XP_011516744.1 | ||||
XM_011518444.2 | Intron | XP_011516746.1 | ||||
XM_017014567.1 | Intron | XP_016870056.1 | ||||
XM_017014568.1 | Intron | XP_016870057.1 | ||||
XM_017014569.1 | Intron | XP_016870058.1 | ||||
XM_017014570.1 | Intron | XP_016870059.1 |
ZBTB26 - zinc finger and BTB domain containing 26 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
Set Membership: |
HapMap |