Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACAATGCTTAGTTCTGATCAATTCA[A/G]TCATATTCAATGTAAGAGACATTTA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
1 submissions
|
||||||||||||||||||||
Phenotype: |
|||||||||||||||||||||
Literature Links: |
METTL11B PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
METTL11B - methyltransferase like 11B | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001136107.1 | Intron | NP_001129579.1 | ||||
XM_011509232.2 | Intron | XP_011507534.1 | ||||
XM_011509233.2 | Intron | XP_011507535.1 | ||||
XM_011509234.2 | Intron | XP_011507536.1 |
MIR3119-1 - microRNA 3119-1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR3119-2 - microRNA 3119-2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |