Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGAAGTTGTACGGAGAGAGGGCAGT[A/G]CAGACTAAAGAAAAATCCACAAAAG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 612061 | ||||||||||||||||||||
Literature Links: |
LOC105375218 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
LOC105375218 - uncharacterized LOC105375218 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR550A1 - microRNA 550a-1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR550B1 - microRNA 550b-1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ZNRF2 - zinc and ring finger 2, E3 ubiquitin protein ligase | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_147128.3 | Intron | NP_667339.1 |