Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GACCAGACTGGTGCACTTAAGTCCC[A/C]CGGCCTCGGAAAAGCAGCTCCACCT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
1 submissions
|
||||||||||||||||||||
Phenotype: |
MIM: 601572 MIM: 614760 | ||||||||||||||||||||
Literature Links: |
CAPZB PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CAPZB - capping actin protein of muscle Z-line beta subunit | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001206540.2 | Intron | NP_001193469.1 | ||||
NM_001206541.2 | Intron | NP_001193470.1 | ||||
NM_001282162.1 | Intron | NP_001269091.1 | ||||
NM_001313932.1 | Intron | NP_001300861.1 | ||||
NM_004930.4 | Intron | NP_004921.1 | ||||
XM_006710938.3 | Intron | XP_006711001.1 | ||||
XM_011542228.2 | Intron | XP_011540530.1 | ||||
XM_011542229.2 | Intron | XP_011540531.1 | ||||
XM_011542230.2 | Intron | XP_011540532.1 | ||||
XM_017002428.1 | Intron | XP_016857917.1 | ||||
XM_017002429.1 | Intron | XP_016857918.1 | ||||
XM_017002430.1 | Intron | XP_016857919.1 |
PQLC2 - PQ loop repeat containing 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |