Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGTTTCCTTTCCCATTCAGCCATTA[A/G]GAGTTTGCACATCATTATTAGGGTT
Species: |
Human | |||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||
Phenotype: |
MIM: 605086 MIM: 609714 | |||||||||||||||||||||||
Literature Links: |
ADCY10P1 PubMed Links | |||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU)
|
|||
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR - Not Available | |||||
AMR - Not Available |
ADCY10P1 - adenylate cyclase 10, soluble pseudogene 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC105375056 - uncharacterized LOC105375056 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TREM2 - triggering receptor expressed on myeloid cells 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TREML1 - triggering receptor expressed on myeloid cells like 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001271807.1 | 1263 | UTR 3 | NP_001258736.1 | |||
NM_001271808.1 | 1263 | UTR 3 | NP_001258737.1 | |||
NM_178174.3 | 1263 | UTR 3 | NP_835468.1 | |||
XM_017010822.1 | 1263 | UTR 3 | XP_016866311.1 | |||
XM_017010823.1 | 1263 | UTR 3 | XP_016866312.1 | |||
XM_017010824.1 | 1263 | UTR 3 | XP_016866313.1 | |||
XM_017010825.1 | 1263 | UTR 3 | XP_016866314.1 |
Set Membership: |
HapMap |