Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCCGCCCTTCCCCGCGCCCCCGCCG[C/G]CGCCCTTCTGTTTCTCCGCTTCCTG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 142994 | ||||||||||||||||||||
Literature Links: |
MNX1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
MNX1 - motor neuron and pancreas homeobox 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001165255.1 | 694 | Missense Mutation | GCC,GGC | A,G 104 | NP_001158727.1 | |
NM_005515.3 | 694 | Missense Mutation | GCC,GGC | A,G 316 | NP_005506.3 |
MNX1-AS1 - MNX1 antisense RNA 1 (head to head) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MNX1-AS2 - MNX1 antisense RNA 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |