Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CTCCCTGACAAACATTACTGAAAAC[A/C]CGGGTTATTCCCCTCCTCCTCAGTA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 191163 | ||||||||||||||||||||
Literature Links: |
LOC100130476 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
LOC100130476 - uncharacterized LOC100130476 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC107986649 - uncharacterized LOC107986649 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TNFAIP3 - TNF alpha induced protein 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001270507.1 | Intron | NP_001257436.1 | ||||
NM_001270508.1 | Intron | NP_001257437.1 | ||||
NM_006290.3 | Intron | NP_006281.1 | ||||
XM_005267119.1 | Intron | XP_005267176.1 | ||||
XM_006715555.1 | Intron | XP_006715618.1 | ||||
XM_011536095.1 | Intron | XP_011534397.1 | ||||
XM_011536096.1 | Intron | XP_011534398.1 |