Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGAGGGAGCCAAGTGTTAATTCCAA[C/T]TGCTACTCCCACCCCCAAACCCACC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 142980 MIM: 142981 MIM: 611576 | ||||||||||||||||||||
Literature Links: |
HOXD-AS2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
HOXD-AS2 - HOXD cluster antisense RNA 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
HOXD3 - homeobox D3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_006898.4 | Intron | NP_008829.3 | ||||
XM_005246509.3 | Intron | XP_005246566.1 | ||||
XM_005246510.4 | Intron | XP_005246567.1 | ||||
XM_005246511.3 | Intron | XP_005246568.1 | ||||
XM_005246513.4 | Intron | XP_005246570.1 | ||||
XM_006712477.2 | Intron | XP_006712540.1 | ||||
XM_011511065.2 | Intron | XP_011509367.1 | ||||
XM_011511066.2 | Intron | XP_011509368.1 |
HOXD4 - homeobox D4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR10B - microRNA 10b | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |