Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCCCAGAAGCATGAAAGTCACACAT[T/G]TTAAAAAATACTGTTTAATTTTCTA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 605145 MIM: 615712 | ||||||||||||||||||||
Literature Links: |
ANKH PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ANKH - ANKH inorganic pyrophosphate transport regulator | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_054027.4 | 3757 | UTR 3 | NP_473368.1 | |||
XM_011514067.1 | 3757 | Intron | XP_011512369.1 | |||
XM_017009644.1 | 3757 | UTR 3 | XP_016865133.1 |
LOC100130744 - uncharacterized LOC100130744 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
OTULIN - OTU deubiquitinase with linear linkage specificity | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_138348.4 | 3757 | Intron | NP_612357.4 | |||
XM_011514151.2 | 3757 | Intron | XP_011512453.1 | |||
XM_011514152.2 | 3757 | Intron | XP_011512454.1 | |||
XM_011514154.2 | 3757 | Intron | XP_011512456.1 | |||
XM_017010015.1 | 3757 | Intron | XP_016865504.1 |