Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGCAGCGGGCGGAGCAAACGCAGCA[A/C]CTCACGGTCCCCGGGGTCGGCCAGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 607611 MIM: 608076 | ||||||||||||||||||||
Literature Links: |
PLSCR3 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
PLSCR3 - phospholipid scramblase 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001201576.1 | 969 | Missense Mutation | NP_001188505.1 | |||
NM_020360.3 | 969 | Missense Mutation | NP_065093.2 |
TMEM256 - transmembrane protein 256 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TMEM256-PLSCR3 - TMEM256-PLSCR3 readthrough (NMD candidate) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TNK1 - tyrosine kinase non receptor 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |