Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AACACTCTGGAACATCGGAAGAGGA[G/T]TTCTTTGCTATGTTCCAAGCCATCT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 607763 MIM: 609848 | ||||||||||||||||||||||||||||||||||||||||||||||||||
Literature Links: |
ACAP1 PubMed Links | ||||||||||||||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | ||||||
---|---|---|---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU)
|
||||||
EAS
|
African American - Not Available | YRI (Yoruba)
|
||||||
SAS
|
Chinese - Not Available | JPT (Japanese)
|
||||||
AFR
|
Japanese - Not Available | CHB (Han Chinese)
|
||||||
EUR
|
||||||||
AMR
|
ACAP1 - ArfGAP with coiled-coil, ankyrin repeat and PH domains 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_014716.3 | 2248 | Intron | NP_055531.1 |
KCTD11 - potassium channel tetramerization domain containing 11 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001002914.2 | 2248 | UTR 3 | NP_001002914.1 |
TMEM95 - transmembrane protein 95 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001320435.1 | 2248 | Intron | NP_001307364.1 | |||
NM_001320436.1 | 2248 | Intron | NP_001307365.1 | |||
NM_198154.2 | 2248 | Intron | NP_937797.1 | |||
XM_017024565.1 | 2248 | Intron | XP_016880054.1 | |||
XM_017024566.1 | 2248 | Intron | XP_016880055.1 | |||
XM_017024567.1 | 2248 | Intron | XP_016880056.1 | |||
XM_017024568.1 | 2248 | Intron | XP_016880057.1 | |||
XM_017024569.1 | 2248 | Intron | XP_016880058.1 | |||
XM_017024570.1 | 2248 | Intron | XP_016880059.1 | |||
XM_017024571.1 | 2248 | Intron | XP_016880060.1 |
Set Membership: |
HapMap |