Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GTTTTGCCTATTTAACAGTGGATCT[A/G]TTTGGTTATTAGCTGAAAAATCCTT
Species: |
Human | |||||||||||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 607083 | |||||||||||||||||||||||||||||||||||||||||||||||
Literature Links: |
LETM2 PubMed Links | |||||||||||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | ||||||
---|---|---|---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU)
|
||||||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | ||||||
SAS
|
Chinese - Not Available | JPT (Japanese)
|
||||||
AFR
|
Japanese - Not Available | CHB (Han Chinese)
|
||||||
EUR
|
||||||||
AMR
|
LETM2 - leucine zipper and EF-hand containing transmembrane protein 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001199659.2 | 1248 | Intron | NP_001186588.1 | |||
NM_001199660.2 | 1248 | Intron | NP_001186589.1 | |||
NM_001286787.1 | 1248 | Intron | NP_001273716.1 | |||
NM_001286819.1 | 1248 | Intron | NP_001273748.1 | |||
NM_001286821.1 | 1248 | Intron | NP_001273750.1 | |||
NM_144652.3 | 1248 | Intron | NP_653253.1 | |||
XM_006716291.3 | 1248 | Intron | XP_006716354.1 | |||
XM_011544406.1 | 1248 | Intron | XP_011542708.1 | |||
XM_011544407.1 | 1248 | Intron | XP_011542709.1 | |||
XM_011544408.2 | 1248 | UTR 5 | XP_011542710.1 | |||
XM_011544409.2 | 1248 | Intron | XP_011542711.1 | |||
XM_011544410.2 | 1248 | Intron | XP_011542712.1 | |||
XM_017013051.1 | 1248 | Intron | XP_016868540.1 | |||
XM_017013052.1 | 1248 | Intron | XP_016868541.1 | |||
XM_017013053.1 | 1248 | UTR 5 | XP_016868542.1 | |||
XM_017013054.1 | 1248 | Intron | XP_016868543.1 | |||
XM_017013055.1 | 1248 | Intron | XP_016868544.1 | |||
XM_017013056.1 | 1248 | Intron | XP_016868545.1 | |||
XM_017013057.1 | 1248 | UTR 5 | XP_016868546.1 |
WHSC1L1 - Wolf-Hirschhorn syndrome candidate 1-like 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
Set Membership: |
HapMap |