Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CTGAAAATATCCTGAGGAACACTAA[A/G]GCTCTGGGGACTGTAGGCTGGGAAC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 604378 | ||||||||||||||||||||
Literature Links: |
BECN1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
BECN1 - beclin 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001313998.1 | Intron | NP_001300927.1 | ||||
NM_001313999.1 | Intron | NP_001300928.1 | ||||
NM_001314000.1 | Intron | NP_001300929.1 | ||||
NM_003766.4 | Intron | NP_003757.1 | ||||
XM_005257759.2 | Intron | XP_005257816.1 | ||||
XM_005257760.3 | Intron | XP_005257817.1 | ||||
XM_011525421.2 | Intron | XP_011523723.1 | ||||
XM_017025262.1 | Intron | XP_016880751.1 | ||||
XM_017025263.1 | Intron | XP_016880752.1 | ||||
XM_017025264.1 | Intron | XP_016880753.1 |
CNTD1 - cyclin N-terminal domain containing 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR6781 - microRNA 6781 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |