Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CATCTCTGGCTGCATATAGGATTCC[G/T]TCCGCAGGAACCAGCTGCTCACTCT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 611230 MIM: 604272 MIM: 131222 | ||||||||||||||||||||
Literature Links: |
NCAPH2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
NCAPH2 - non-SMC condensin II complex subunit H2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ODF3B - outer dense fiber of sperm tails 3B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SCO2 - SCO2 cytochrome c oxidase assembly protein | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TYMP - thymidine phosphorylase | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001113755.2 | 812 | Silent Mutation | NP_001107227.1 | |||
NM_001113756.2 | 812 | Silent Mutation | NP_001107228.1 | |||
NM_001257988.1 | 812 | Silent Mutation | NP_001244917.1 | |||
NM_001257989.1 | 812 | Silent Mutation | NP_001244918.1 | |||
NM_001953.4 | 812 | Silent Mutation | NP_001944.1 |