Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GTGGAAACAGCTGCGGTGTGAAATT[C/A]CTCCTGCGTCAGCCAGCGAGCACCT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
7 submissions
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 604933 MIM: 613931 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
HPDL PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
HPDL - 4-hydroxyphenylpyruvate dioxygenase like | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MUTYH - mutY DNA glycosylase | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001048171.1 | 1406 | Nonsense Mutation | GAA,TAA | E,* 466 | NP_001041636.1 | |
NM_001048172.1 | 1406 | Nonsense Mutation | GAA,TAA | E,* 453 | NP_001041637.1 | |
NM_001048173.1 | 1406 | Nonsense Mutation | GAA,TAA | E,* 452 | NP_001041638.1 | |
NM_001048174.1 | 1406 | Nonsense Mutation | GAA,TAA | E,* 452 | NP_001041639.1 | |
NM_001128425.1 | 1406 | Nonsense Mutation | GAA,TAA | E,* 480 | NP_001121897.1 | |
NM_001293190.1 | 1406 | Nonsense Mutation | GAA,TAA | E,* 467 | NP_001280119.1 | |
NM_001293191.1 | 1406 | Nonsense Mutation | GAA,TAA | E,* 463 | NP_001280120.1 | |
NM_001293192.1 | 1406 | Nonsense Mutation | GAA,TAA | E,* 360 | NP_001280121.1 | |
NM_001293195.1 | 1406 | Nonsense Mutation | GAA,TAA | E,* 452 | NP_001280124.1 | |
NM_001293196.1 | 1406 | Nonsense Mutation | GAA,TAA | E,* 360 | NP_001280125.1 | |
NM_012222.2 | 1406 | Nonsense Mutation | GAA,TAA | E,* 477 | NP_036354.1 | |
XM_011541497.2 | 1406 | Nonsense Mutation | GAA,TAA | E,* 472 | XP_011539799.1 | |
XM_011541498.1 | 1406 | Nonsense Mutation | GAA,TAA | E,* 466 | XP_011539800.1 | |
XM_011541499.1 | 1406 | Nonsense Mutation | GAA,TAA | E,* 466 | XP_011539801.1 | |
XM_011541500.2 | 1406 | Nonsense Mutation | GAA,TAA | E,* 466 | XP_011539802.1 | |
XM_011541501.2 | 1406 | Nonsense Mutation | GAA,TAA | E,* 466 | XP_011539803.1 | |
XM_011541502.2 | 1406 | Nonsense Mutation | GAA,TAA | E,* 466 | XP_011539804.1 | |
XM_011541503.2 | 1406 | Nonsense Mutation | GAA,TAA | E,* 466 | XP_011539805.1 | |
XM_011541504.2 | 1406 | Nonsense Mutation | GAA,TAA | E,* 463 | XP_011539806.1 | |
XM_011541505.2 | 1406 | Nonsense Mutation | GAA,TAA | E,* 326 | XP_011539807.1 | |
XM_011541506.1 | 1406 | Nonsense Mutation | GAA,TAA | E,* 326 | XP_011539808.1 | |
XM_011541507.2 | 1406 | Nonsense Mutation | GAA,TAA | E,* 314 | XP_011539809.2 | |
XM_017001331.1 | 1406 | Nonsense Mutation | GAA,TAA | E,* 466 | XP_016856820.1 | |
XM_017001332.1 | 1406 | Nonsense Mutation | GAA,TAA | E,* 466 | XP_016856821.1 | |
XM_017001333.1 | 1406 | Nonsense Mutation | GAA,TAA | E,* 466 | XP_016856822.1 | |
XM_017001334.1 | 1406 | Nonsense Mutation | GAA,TAA | E,* 453 | XP_016856823.1 | |
XM_017001335.1 | 1406 | Nonsense Mutation | GAA,TAA | E,* 360 | XP_016856824.1 | |
XM_017001336.1 | 1406 | Nonsense Mutation | GAA,TAA | E,* 337 | XP_016856825.1 | |
XM_017001337.1 | 1406 | Nonsense Mutation | GAA,TAA | E,* 337 | XP_016856826.1 | |
XM_017001338.1 | 1406 | Nonsense Mutation | GAA,TAA | E,* 337 | XP_016856827.1 | |
XM_017001339.1 | 1406 | Nonsense Mutation | GAA,TAA | E,* 337 | XP_016856828.1 |
TOE1 - target of EGR1, member 1 (nuclear) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |