Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CGGCTAAGGCAGGCCCAGGGAAGCT[A/G]GGGAGATGAATCCAGGAGTCCGGCC
Species: |
Human | |||||||||||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
33 submissions
|
|||||||||||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 603911 | |||||||||||||||||||||||||||||||||||||||||||||||
Literature Links: |
DCDC2B PubMed Links | |||||||||||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | ||||||
---|---|---|---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU)
|
||||||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | ||||||
SAS
|
Chinese - Not Available | JPT (Japanese)
|
||||||
AFR
|
Japanese - Not Available | CHB (Han Chinese)
|
||||||
EUR
|
||||||||
AMR
|
DCDC2B - doublecortin domain containing 2B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
EIF3I - eukaryotic translation initiation factor 3 subunit I | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_003757.3 | Intron | NP_003748.1 | ||||
XM_017002671.1 | Intron | XP_016858160.1 |
MTMR9LP - myotubularin related protein 9-like, pseudogene | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TMEM234 - transmembrane protein 234 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_019118.4 | Intron | NP_061991.3 | ||||
XM_011541795.2 | Intron | XP_011540097.1 | ||||
XM_017001812.1 | Intron | XP_016857301.1 | ||||
XM_017001813.1 | Intron | XP_016857302.1 | ||||
XM_017001814.1 | Intron | XP_016857303.1 | ||||
XM_017001815.1 | Intron | XP_016857304.1 | ||||
XM_017001816.1 | Intron | XP_016857305.1 | ||||
XM_017001817.1 | Intron | XP_016857306.1 | ||||
XM_017001818.1 | Intron | XP_016857307.1 | ||||
XM_017001819.1 | Intron | XP_016857308.1 | ||||
XM_017001820.1 | Intron | XP_016857309.1 | ||||
XM_017001821.1 | Intron | XP_016857310.1 | ||||
XM_017001822.1 | Intron | XP_016857311.1 | ||||
XM_017001823.1 | Intron | XP_016857312.1 | ||||
XM_017001824.1 | Intron | XP_016857313.1 | ||||
XM_017001825.1 | Intron | XP_016857314.1 | ||||
XM_017001826.1 | Intron | XP_016857315.1 | ||||
XM_017001827.1 | Intron | XP_016857316.1 | ||||
XM_017001828.1 | Intron | XP_016857317.1 | ||||
XM_017001829.1 | Intron | XP_016857318.1 | ||||
XM_017001830.1 | Intron | XP_016857319.1 | ||||
XM_017001831.1 | Intron | XP_016857320.1 |
Set Membership: |
HapMap |