Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGCTTTCTGGGGCACTGGTCCACAA[C/T]GGCCCCACACTCTTACTGTGCTCAG
Species: |
Human | |||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||
Phenotype: |
MIM: 611965 | |||||||||||||||||||||||
Literature Links: |
C3orf49 PubMed Links | |||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR - Not Available | |||||
AMR - Not Available |
C3orf49 - chromosome 3 open reading frame 49 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
THOC7 - THO complex 7 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |