Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CGGCTATGCCGCTTGCTCTGCTCGT[C/T]CTGTTGCTCCTGGGGCCCGGCGGCT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 611453 MIM: 610272 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
DBNDD2 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
DBNDD2 - dysbindin domain containing 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR6812 - microRNA 6812 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PIGT - phosphatidylinositol glycan anchor biosynthesis class T | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001184728.2 | 45 | Silent Mutation | GTC,GTT | V,V 11 | NP_001171657.1 | |
NM_001184729.2 | 45 | Silent Mutation | GTC,GTT | V,V 11 | NP_001171658.1 | |
NM_001184730.2 | 45 | Silent Mutation | GTC,GTT | V,V 11 | NP_001171659.1 | |
NM_015937.5 | 45 | Silent Mutation | GTC,GTT | V,V 11 | NP_057021.2 | |
XM_005260430.2 | 45 | Silent Mutation | GTC,GTT | V,V 11 | XP_005260487.1 | |
XM_005260432.2 | 45 | UTR 5 | XP_005260489.1 |
SYS1-DBNDD2 - SYS1-DBNDD2 readthrough (NMD candidate) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |