Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGCGCTCGGCTTCAAGTACGACTAC[A/G]CGGCGGGCGGCGGCGGTGGCGACGG
Species: |
Human | ||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||
Phenotype: |
MIM: 611400 MIM: 142975 MIM: 142976 | ||||||||||||||||||||||||||
Literature Links: |
HOTAIR PubMed Links | ||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU)
|
|||
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR - Not Available | Japanese - Not Available | JPT (Japanese)
|
|||
EUR - Not Available | |||||
AMR - Not Available |
HOTAIR - HOX transcript antisense RNA | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
HOXC12 - homeobox C12 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
HOXC13 - homeobox C13 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |