Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GATACTACTAGGGGAGAATCAAAGC[A/C]CAAAGAAGAAAGAAAAACGGGCAAA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 606493 MIM: 172250 MIM: 616750 | ||||||||||||||||||||
Literature Links: |
EXOSC1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
EXOSC1 - exosome component 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001318362.1 | Intron | NP_001305291.1 | ||||
NM_001318363.1 | Intron | NP_001305292.1 | ||||
NM_001318364.1 | Intron | NP_001305293.1 | ||||
NM_001318365.1 | Intron | NP_001305294.1 | ||||
NM_001318366.1 | Intron | NP_001305295.1 | ||||
NM_016046.4 | Intron | NP_057130.1 | ||||
XM_011539847.2 | Intron | XP_011538149.1 | ||||
XM_017016304.1 | Intron | XP_016871793.1 |
PGAM1 - phosphoglycerate mutase 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ZDHHC16 - zinc finger DHHC-type containing 16 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |