Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGACCTTTCTGAGAAGTTGGTATGG[G/T]GTAACACTAAAGTAGGTGGTTCGTG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 613433 MIM: 612194 MIM: 616292 | ||||||||||||||||||||
Literature Links: |
HAUS6 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
HAUS6 - HAUS augmin like complex subunit 6 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RRAGA - Ras related GTP binding A | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_006570.4 | 1450 | UTR 3 | NP_006561.1 |
SAXO1 - stabilizer of axonemal microtubules 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |