Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCGGCGCGTTGGAGGCGGCCATGGC[A/G]AAGCAGTACGACTCGGTGGAGTGCC
Species: |
Human | |||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||
Phenotype: |
MIM: 603251 MIM: 613405 MIM: 604722 | |||||||||||||||||||||||
Literature Links: |
CDK9 PubMed Links | |||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU)
|
|||
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR - Not Available | |||||
AMR - Not Available |
CDK9 - cyclin dependent kinase 9 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001261.3 | 129 | Silent Mutation | GCA,GCG | A,A 2 | NP_001252.1 | |
XM_017014184.1 | 129 | Intron | XP_016869673.1 |
MIR2861 - microRNA 2861 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR3960 - microRNA 3960 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SH2D3C - SH2 domain containing 3C | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
Set Membership: |
HapMap |