Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AAAGTGGATTGGAGACTGTGGCTTA[A/G]GCTTGCACCACAAGCAAAAGCTTGA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 612818 MIM: 606020 | ||||||||||||||||||||
Literature Links: |
NUSAP1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
NUSAP1 - nucleolar and spindle associated protein 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001243142.1 | Intron | NP_001230071.1 | ||||
NM_001243143.1 | Intron | NP_001230072.1 | ||||
NM_001243144.1 | Intron | NP_001230073.1 | ||||
NM_001301136.1 | Intron | NP_001288065.1 | ||||
NM_016359.4 | Intron | NP_057443.2 | ||||
NM_018454.7 | Intron | NP_060924.4 | ||||
XM_005254428.2 | Intron | XP_005254485.1 | ||||
XM_005254430.4 | Intron | XP_005254487.1 | ||||
XM_005254431.2 | Intron | XP_005254488.1 | ||||
XM_006720559.2 | Intron | XP_006720622.1 | ||||
XM_006720560.3 | Intron | XP_006720623.1 | ||||
XM_006720561.2 | Intron | XP_006720624.1 | ||||
XM_006720562.2 | Intron | XP_006720625.1 | ||||
XM_006720563.2 | Intron | XP_006720626.1 | ||||
XM_017022294.1 | Intron | XP_016877783.1 | ||||
XM_017022295.1 | Intron | XP_016877784.1 |
OIP5 - Opa interacting protein 5 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |